shRNA Adeno-associated Virus Serotype 2, pH1-(Krtap26-1-shRNA-Seq1)(CAT#: AAV-SI3090WQ)

This product is a Krtap26-1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Krtap26-1 gene is essential for the formation of a rigid and resistant hair shaft. The expression of Krtap26-1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Krtap26-1-shRNA-Seq1
Related Target/Protein Krtap26-1
Region 3UTR
TargetSeq GCTTCTTTCTGAGTAGCGATT
NCBI RefSeq NM_027105
Titer >1*10^10 GC/mL
Target Gene
Gene ID 388818
Uniprot ID Q6PEX3

Related Products