shRNA Adeno-associated Virus Serotype 2, pH1-(LRRN4-shRNA-Seq3)(CAT#: AAV-SI2465WQ)

This product is a LRRN4-shRNA encoding AAV, which is based on AAV-2 serotype. The LRRN4 gene may play an important role in hippocampus-dependent long-lasting memory. The expression of LRRN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LRRN4-shRNA-Seq3
Related Target/Protein LRRN4
Region CDS
TargetSeq GATGCAAAGAGAACTGTCCTA
NCBI RefSeq NM_152611
Alternative Names NLRR4; NLRR-4; C20orf75; dJ1056H1.1
Titer >1*10^10 GC/mL
Related Diseases Nervous system disease
Target Gene
Gene ID 164312
Uniprot ID Q8WUT4

Related Products