shRNA Adeno-associated Virus Serotype 2, pH1-(MRPL16-shRNA-Seq1)(CAT#: AAV-SI0716WQ)
This product is a MRPL16-shRNA encoding AAV, which is based on AAV-2 serotype. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | MRPL16-shRNA-Seq1 |
Related Target/Protein | MRPL16 |
Region | 3UTR |
TargetSeq | GTGTAGGAGATAACTGTATAT |
NCBI RefSeq | NM_017840 |
Alternative Names | L16mt; MRP-L16; PNAS-111 |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancers |