shRNA Adeno-associated Virus Serotype 2, pH1-(NECAP1-shRNA-Seq2)(CAT#: AAV-SI0972WQ)
This product is a NECAP1-shRNA encoding AAV, which is based on AAV-2 serotype. The NECAP1 gene encodes a protein containing two characteristic WXXF motifs and the encoded protein localizes to clathrin-coated vesicles, where it binds components of the adapter protein complexes and aids in endocytosis. The expression of NECAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | NECAP1-shRNA-Seq2 |
Related Target/Protein | NECAP1 |
Region | CDS |
TargetSeq | CTTCGACTTTAATGTCTCCTT |
NCBI RefSeq | NM_015509 |
Alternative Names | EIEE21 |
Titer | >1*10^10 GC/mL |
Related Diseases | Retinal Degeneration |