shRNA Adeno-associated Virus Serotype 2, pH1-(Olfr1532-ps1-shRNA-Seq3)(CAT#: AAV-SI2884WQ)

This product is a Olfr1532-ps1-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr1532-ps1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1532-ps1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Olfr1532-ps1-shRNA-Seq3
Related Target/Protein Olfr1532-ps1
Region CDS
TargetSeq GTGATGTCCTATGACCGCTAT
NCBI RefSeq NM_001011542
Alternative Names Olfr708; MOR260-6P; MOR260-9P; GA_x6K02T2PBJ9-9297671-9298594
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258173
Uniprot ID A0A0R4J8U2

Related Products