shRNA Adeno-associated Virus Serotype 2, pH1-(PATL1-shRNA-Seq1)(CAT#: AAV-SI0604WQ)
This product is a PATL1-shRNA encoding AAV, which is based on AAV-2 serotype. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PATL1-shRNA-Seq1 |
Related Target/Protein | PATL1 |
Region | CDS |
TargetSeq | CATTACCAAGGCGGTCAACTT |
NCBI RefSeq | NM_152716 |
Alternative Names | Pat1b; hPat1b |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatitis C virus (HCV) infection |