shRNA Adeno-associated Virus Serotype 2, pH1-(Poc5-shRNA-Seq5)(CAT#: AAV-SI2743WQ)
This product is a Poc5-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Poc5-shRNA-Seq5 |
Related Target/Protein | Poc5 |
Region | CDS |
TargetSeq | GAAGACAATTACAGCCCGGAT |
NCBI RefSeq | NM_026173 |
Alternative Names | C5orf37 |
Titer | >1*10^10 GC/mL |