shRNA Adeno-associated Virus Serotype 2, pH1-(Poc5-shRNA-Seq5)(CAT#: AAV-SI2743WQ)

This product is a Poc5-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Poc5-shRNA-Seq5
Related Target/Protein Poc5
Region CDS
TargetSeq GAAGACAATTACAGCCCGGAT
NCBI RefSeq NM_026173
Alternative Names C5orf37
Titer >1*10^10 GC/mL
Target Gene
Gene ID 134359
Uniprot ID Q8NA72

Related Products