shRNA Adeno-associated Virus Serotype 2, pH1-(RBM33-shRNA-Seq5)(CAT#: AAV-SI2959WQ)
This product is a RBM33-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of RBM33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | RBM33-shRNA-Seq5 |
| Related Target/Protein | RBM33 |
| Region | CDS |
| TargetSeq | GCTTAAAGATAGAAGAACAGA |
| NCBI RefSeq | NM_053043 |
| Alternative Names | PRR8 |
| Titer | >1*10^10 GC/mL |
