shRNA Adeno-associated Virus Serotype 2, pH1-(RTBDN-shRNA-Seq1)(CAT#: AAV-SI0874WQ)
This product is a RTBDN-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by RTBDN gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. The expression of RTBDN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | RTBDN-shRNA-Seq1 |
| Related Target/Protein | RTBDN |
| Region | CDS |
| TargetSeq | CCTTACCTATGGACAGACCTT |
| NCBI RefSeq | NM_031429 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Eye disease |
