shRNA Adeno-associated Virus Serotype 2, pH1-(Scg2-shRNA-Seq1)(CAT#: AAV-SI3122WQ)
This product is a Scg2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Scg2 gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins and is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The expression of Scg2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Scg2-shRNA-Seq1 |
| Related Target/Protein | Scg2 |
| Region | CDS |
| TargetSeq | CCCTTGATTCTCAGTCTATTT |
| NCBI RefSeq | NM_009129 |
| Alternative Names | SN; CHGC; EM66; SgII |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Nervous system disease |