shRNA Adeno-associated Virus Serotype 2, pH1-(SF3A2-shRNA-Seq2)(CAT#: AAV-SI0561WQ)
This product is a SF3A2-shRNA encoding AAV, which is based on AAV-2 serotype. The SF3A2 gene encodes subunit 2 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SF3A2-shRNA-Seq2 |
Related Target/Protein | SF3A2 |
Region | CDS |
TargetSeq | CTACGAGACCATTGCCTTCAA |
NCBI RefSeq | NM_007165 |
Alternative Names | PRP11; SAP62; PRPF11; SF3a66 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mitotic chromosome segregation |