shRNA Adeno-associated Virus Serotype 2, pH1-(SPANXN4-shRNA-Seq2)(CAT#: AAV-SI0852WQ)
This product is a SPANXN4-shRNA encoding AAV, which is based on AAV-2 serotype. The SPANXN4 gene represents one of several duplicated family members that are located on the X chromosome. The expression of SPANXN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SPANXN4-shRNA-Seq2 |
Related Target/Protein | SPANXN4 |
Region | CDS |
TargetSeq | CTGAACAGAGTTTGAAAGAGA |
NCBI RefSeq | NM_001009613 |
Alternative Names | CT11.9 |
Titer | >1*10^10 GC/mL |