shRNA Adeno-associated Virus Serotype 2, pH1-(SUN5-shRNA-Seq2)(CAT#: AAV-SI0572WQ)
This product is a SUN5-shRNA encoding AAV, which is based on AAV-2 serotype. The SUN5 encoded by this gene appears to play a role in the meiotic stage of spermatogenesis. The encoded protein localizes to the junction between the sperm head and body and may be involved in nuclear envelope reconstitution and nuclear migration. Mutations in this gene have been implicated in acephalic spermatozoa syndrome. The expression of SUN5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SUN5-shRNA-Seq2 |
| Related Target/Protein | SUN5 |
| Region | CDS |
| TargetSeq | CTCATGGAGAAGACAGGCATT |
| NCBI RefSeq | NM_080675 |
| Alternative Names | SPAG4L; SPGF16; TSARG4; dJ726C3.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Acephalic spermatozoa syndrome |