shRNA Adeno-associated Virus Serotype 2, pH1-(Tac4-shRNA-Seq1)(CAT#: AAV-SI3085WQ)

This product is a Tac4-shRNA encoding AAV, which is based on AAV-2 serotype. The products of Tac4 gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The expression of Tac4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tac4-shRNA-Seq1
Related Target/Protein Tac4
Region CDS
TargetSeq CCCAGCATTGAACTTAAGCTT
NCBI RefSeq NM_053093
Alternative Names EK; HK1; HK-1; PPT-C
Titer >1*10^10 GC/mL
Related Diseases Nervous system disease
Target Gene
Gene ID 255061
Uniprot ID Q86UU9

Related Products