shRNA Adeno-associated Virus Serotype 2, pH1-(TTC21A-shRNA-Seq1)(CAT#: AAV-SI0789WQ)
This product is a TTC21A-shRNA encoding AAV, which is based on AAV-2 serotype. Bi-allelic Mutations in TTC21A Induce Asthenoteratospermia in Humans and Mice. The expression of TTC21A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TTC21A-shRNA-Seq1 |
| Related Target/Protein | TTC21A |
| Region | CDS |
| TargetSeq | GCCGTGATCTTGAATCCTGTA |
| NCBI RefSeq | NM_145755 |
| Alternative Names | STI2; SPGF37; IFT139A |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Asthenoteratospermia |