shRNA Adeno-associated Virus Serotype 2, pH1-(Vipar-shRNA-Seq1)(CAT#: AAV-SI3182WQ)

This product is a Vipar-shRNA encoding AAV, which is based on AAV-2 serotype. The Vipar gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). The expression of Vipar-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Vipar-shRNA-Seq1
Related Target/Protein Vipar
Region 3UTR
TargetSeq CCAGCCTTTGAGCACATGTAT
NCBI RefSeq NM_134044
Alternative Names SPE39; VIPAR; SPE-39; VPS16B; hSPE-39; C14orf133; VIPAS39
Titer >1*10^10 GC/mL
Related Diseases Arthrogryposis, renal dysfunction, and cholestasis-2
Target Gene
Gene ID 63894
Uniprot ID Q9H9C1

Related Products