shRNA Adeno-associated Virus Serotype 2, pH1-(YPEL3-shRNA-Seq1)(CAT#: AAV-SI0657WQ)

This product is a YPEL3-shRNA encoding AAV, which is based on AAV-2 serotype. The YPEL3 gene is involved in proliferation and apoptosis in myeloid precursor cells. The expression of YPEL3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert YPEL3-shRNA-Seq1
Related Target/Protein YPEL3
Region CDS
TargetSeq GATGATTGTCACCGGAGGTAT
NCBI RefSeq NM_031477
Alternative Names Ypel3; Suap
Titer >1*10^10 GC/mL
Related Diseases Mammary tumor
Target Gene
Gene ID 83719
Uniprot ID P61236

Related Products