shRNA Adeno-associated Virus Serotype 2, pH1-(Zpbp-shRNA-Seq5)(CAT#: AAV-SI2810WQ)

This product is a Zpbp-shRNA encoding AAV, which is based on AAV-2 serotype. ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida. The expression of Zpbp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Zpbp-shRNA-Seq5
Related Target/Protein Zpbp
Region CDS
TargetSeq GTGTAACCCAACGACTGAGAA
NCBI RefSeq NM_015785
Alternative Names ZPBP1
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 11055
Uniprot ID Q9BS86

Related Products