shRNA Adeno-associated Virus Serotype 2, pU6-(A130030D10Rik-shRNA-Seq1)(CAT#: AAV-SI2245WQ)
This product is a A130030D10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by A130030D10Rik gene may play a role in Shh signaling by mediating the ubiquitination of Kif7. The expression of A130030D10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | A130030D10Rik-shRNA-Seq1 |
Related Target/Protein | A130030D10Rik |
Region | 3UTR |
TargetSeq | CGCTAACACTTTGCTGTATTT |
NCBI RefSeq | NM_177783 |
Alternative Names | Zfp650; Znf650; AA409735; AA414972; AA422631; AI646861; AU016126; 1110059H15Rik; 4833421P10Rik; Ubr3 |
Titer | >1*10^10 GC/mL |