shRNA Adeno-associated Virus Serotype 2, pU6-(Adipor1-shRNA-Seq2)(CAT#: AAV-SI1834WQ)
This product is a Adipor1-shRNA encoding AAV, which is based on AAV-2 serotype. The Adipor1 gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. The expression of Adipor1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Adipor1-shRNA-Seq2 |
| Related Target/Protein | Adipor1 |
| Region | CDS |
| TargetSeq | GCTGAAAGACAACGACTACCT |
| NCBI RefSeq | NM_028320 |
| Alternative Names | CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Obesity; Diabetes |