shRNA Adeno-associated Virus Serotype 2, pU6-(APBA3-shRNA-Seq1)(CAT#: AAV-SI0311WQ)
This product is a APBA3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by APBA3 gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. The expression of APBA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | APBA3-shRNA-Seq1 |
Related Target/Protein | APBA3 |
Region | CDS |
TargetSeq | CTATGGCGAGGTGCATATCAA |
NCBI RefSeq | NM_004886 |
Alternative Names | X11L2; mint3; MGC:15815 |
Titer | >1*10^10 GC/mL |
Related Diseases | Alzheimer's disease |