shRNA Adeno-associated Virus Serotype 2, pU6-(Armc5-shRNA-Seq1)(CAT#: AAV-SI2334WQ)
This product is a Armc5-shRNA encoding AAV, which is based on AAV-2 serotype. The Armc5 gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. The expression of Armc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Armc5-shRNA-Seq1 |
| Related Target/Protein | Armc5 |
| Region | 3UTR |
| TargetSeq | CCAGGATGAAGATCTAACGAT |
| NCBI RefSeq | NM_146205 |
| Alternative Names | AIMAH2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | ACTH-independent macronodular adrenal hyperplasia 2 |