shRNA Adeno-associated Virus Serotype 2, pU6-(BBS5-shRNA-Seq2)(CAT#: AAV-SI1512WQ)
This product is a BBS5-shRNA encoding AAV, which is based on AAV-2 serotype. The BBS5 gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. The expression of BBS5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | BBS5-shRNA-Seq2 |
| Related Target/Protein | BBS5 |
| Region | CDS |
| TargetSeq | GTGGATATGTTCTTGGCTTTA |
| NCBI RefSeq | NM_152384 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Bardet-Biedl syndrome |