shRNA Adeno-associated Virus Serotype 2, pU6-(C8orf44-shRNA-Seq2)(CAT#: AAV-SI1518WQ)

This product is a C8orf44-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C8orf44-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C8orf44-shRNA-Seq2
Related Target/Protein C8orf44
Region CDS
TargetSeq GAGACCAGATGTACCGAGTTT
NCBI RefSeq NM_019607
Titer >1*10^10 GC/mL
Target Gene
Gene ID 56260
Uniprot ID Q96CB5

Related Products