shRNA Adeno-associated Virus Serotype 2, pU6-(Cdc42ep2-shRNA-Seq1)(CAT#: AAV-SI2211WQ)
This product is a Cdc42ep2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Cdc42ep2 gene is a member of the Borg family of CDC42 effector proteins. Coexpression of this protein with CDC42 suggested a role of this protein in actin filament assembly and cell shape control. The expression of Cdc42ep2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Cdc42ep2-shRNA-Seq1 |
| Related Target/Protein | Cdc42ep2 |
| Region | CDS |
| TargetSeq | CTTTGACCTTCCCTTCCAGTT |
| NCBI RefSeq | NM_026772 |
| Alternative Names | CEP2; BORG1 |
| Titer | >1*10^10 GC/mL |