shRNA Adeno-associated Virus Serotype 2, pU6-(Csn1s2a-shRNA-Seq1)(CAT#: AAV-SI1843WQ)
This product is a Csn1s2a-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Csn1s2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Csn1s2a-shRNA-Seq1 |
| Related Target/Protein | Csn1s2a |
| Region | 3UTR |
| TargetSeq | CCCATCACCTCCTACTATTAA |
| NCBI RefSeq | NM_007785 |
| Alternative Names | CSN1S2AP; CSN1S2A |
| Titer | >1*10^10 GC/mL |
