shRNA Adeno-associated Virus Serotype 2, pU6-(GLOD4-shRNA-Seq2)(CAT#: AAV-SI0143WQ)
This product is a GLOD4-shRNA encoding AAV, which is based on AAV-2 serotype. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | GLOD4-shRNA-Seq2 |
| Related Target/Protein | GLOD4 |
| Region | 3UTR |
| TargetSeq | CGAGCTTCTTTCTGTGTATAT |
| NCBI RefSeq | NM_016080 |
| Alternative Names | HC71; CGI-150; C17orf25 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular carcinoma |
