shRNA Adeno-associated Virus Serotype 2, pU6-(GOLM1-shRNA-Seq3)(CAT#: AAV-SI0133WQ)
This product is a GOLM1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by GOLM1 is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. The expression of GOLM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | GOLM1-shRNA-Seq3 |
Related Target/Protein | GOLM1 |
Region | CDS |
TargetSeq | GAAGGGAAACGTGCTTGGTAA |
NCBI RefSeq | NM_016548 |
Alternative Names | GP73; HEL46; GOLPH2; C9orf155; PSEC0257; bA379P1.3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Prostate cancer |