shRNA Adeno-associated Virus Serotype 2, pU6-(Gpatch2-shRNA-Seq3)(CAT#: AAV-SI1827WQ)
This product is a Gpatch2-shRNA encoding AAV, which is based on AAV-2 serotype. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Gpatch2-shRNA-Seq3 |
| Related Target/Protein | Gpatch2 |
| Region | CDS |
| TargetSeq | GCATCAGCTTCTGAGAGATAA |
| NCBI RefSeq | NM_026367 |
| Alternative Names | Pfa1; CT110; GPATC2; PPP1R30 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |