shRNA Adeno-associated Virus Serotype 2, pU6-(Hspa4-shRNA-Seq3)(CAT#: AAV-SI1942WQ)
This product is a Hspa4-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Hspa4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Hspa4-shRNA-Seq3 |
| Related Target/Protein | Hspa4 |
| Region | CDS |
| TargetSeq | GACAAGTATTTGCAGTCCTAT |
| NCBI RefSeq | NM_008300 |
| Alternative Names | RY; APG-2; HSPH2; hsp70; hsp70RY; HEL-S-5a; HS24/P52 |
| Titer | >1*10^10 GC/mL |