shRNA Adeno-associated Virus Serotype 2, pU6-(JMJD8-shRNA-Seq3)(CAT#: AAV-SI0155WQ)
This product is a JMJD8-shRNA encoding AAV, which is based on AAV-2 serotype. The JMJD8 gene functions as a positive regulator of TNF-induced NF-kappa-B signaling and regulates angiogenesis and cellular metabolism through interaction with PKM. The expression of JMJD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | JMJD8-shRNA-Seq3 |
| Related Target/Protein | JMJD8 |
| Region | CDS |
| TargetSeq | CAGAAGTGATCTACGGTCGTA |
| NCBI RefSeq | NM_001005920 |
| Alternative Names | PP14397; C16orf20 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancer |