shRNA Adeno-associated Virus Serotype 2, pU6-(LIMS2-shRNA-Seq1)(CAT#: AAV-SI0149WQ)
This product is a LIMS2-shRNA encoding AAV, which is based on AAV-2 serotype. LIMS2 gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The expression of LIMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LIMS2-shRNA-Seq1 |
Related Target/Protein | LIMS2 |
Region | CDS |
TargetSeq | GAAGAACAAGTTTGTGGAGTT |
NCBI RefSeq | NM_017980 |
Alternative Names | LGMD2W; PINCH2; MDRCMTT; PINCH-2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Muscular dystrophy, severe cardiomyopathy and triangular tongues |