shRNA Adeno-associated Virus Serotype 2, pU6-(LIMS2-shRNA-Seq1)(CAT#: AAV-SI0149WQ)
This product is a LIMS2-shRNA encoding AAV, which is based on AAV-2 serotype. LIMS2 gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The expression of LIMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LIMS2-shRNA-Seq1 |
| Related Target/Protein | LIMS2 |
| Region | CDS |
| TargetSeq | GAAGAACAAGTTTGTGGAGTT |
| NCBI RefSeq | NM_017980 |
| Alternative Names | LGMD2W; PINCH2; MDRCMTT; PINCH-2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Muscular dystrophy, severe cardiomyopathy and triangular tongues |