shRNA Adeno-associated Virus Serotype 2, pU6-(LRRC18-shRNA-Seq3)(CAT#: AAV-SI0208WQ)
This product is a LRRC18-shRNA encoding AAV, which is based on AAV-2 serotype. The LRRC18 gene may be involved in the regulation of spermatogenesis and sperm maturation. The expression of LRRC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LRRC18-shRNA-Seq3 |
Related Target/Protein | LRRC18 |
Region | CDS |
TargetSeq | GCTGAAGCAACTCAAGAACAT |
NCBI RefSeq | NM_001006939 |
Alternative Names | UNQ933; UNQ9338; VKGE9338 |
Titer | >1*10^10 GC/mL |