shRNA Adeno-associated Virus Serotype 2, pU6-(MAP6D1-shRNA-Seq1)(CAT#: AAV-SI0197WQ)
This product is a MAP6D1-shRNA encoding AAV, which is based on AAV-2 serotype. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | MAP6D1-shRNA-Seq1 |
Related Target/Protein | MAP6D1 |
Region | CDS |
TargetSeq | GTGAGGAAGAAGTTCACTCCT |
NCBI RefSeq | NM_024871 |
Alternative Names | SL21; MAPO6D1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal cancer |