shRNA Adeno-associated Virus Serotype 2, pU6-(N4bp2l2-shRNA-Seq3)(CAT#: AAV-SI1918WQ)

This product is a N4bp2l2-shRNA encoding AAV, which is based on AAV-2 serotype. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert N4bp2l2-shRNA-Seq3
Related Target/Protein N4bp2l2
Region CDS
TargetSeq CCAAGGATGATGAAATCTATA
NCBI RefSeq NM_201369
Alternative Names CG005; CG016; PFAAP5; 92M18.3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10443
Uniprot ID Q92802

Related Products