shRNA Adeno-associated Virus Serotype 2, pU6-(PCOLCE-shRNA-Seq1)(CAT#: AAV-SI0403WQ)
This product is a PCOLCE-shRNA encoding AAV, which is based on AAV-2 serotype. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PCOLCE-shRNA-Seq1 |
| Related Target/Protein | PCOLCE |
| Region | CDS |
| TargetSeq | GAATGAACTCCTCGTCCAGTT |
| NCBI RefSeq | NM_002593 |
| Alternative Names | PCPE; PCPE1; PCPE-1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Psoriatic arthritis |
