shRNA Adeno-associated Virus Serotype 2, pU6-(Prb1-shRNA-Seq1)(CAT#: AAV-SI2314WQ)
This product is a Prb1-shRNA encoding AAV, which is based on AAV-2 serotype. The Prb1 gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. The expression of Prb1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Prb1-shRNA-Seq1 |
| Related Target/Protein | Prb1 |
| Region | CDS |
| TargetSeq | CGAAGACTCAAATTCTCAGCT |
| NCBI RefSeq | NM_198669 |
| Alternative Names | PM; PMF; PMS; PRB1L; PRB1M |
| Titer | >1*10^10 GC/mL |