shRNA Adeno-associated Virus Serotype 2, pU6-(SAMD8-shRNA-Seq2)(CAT#: AAV-SI0441WQ)
This product is a SAMD8-shRNA encoding AAV, which is based on AAV-2 serotype. SAMD8 is an endoplasmic reticulum (ER) transferase that has no sphingomyelin synthase activity but can convert phosphatidylethanolamine (PE) and ceramide to ceramide phosphoethanolamine (CPE) albeit with low product yield. The expression of SAMD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SAMD8-shRNA-Seq2 |
| Related Target/Protein | SAMD8 |
| Region | CDS |
| TargetSeq | GTAGTCTGATGGGAACTGTAT |
| NCBI RefSeq | NM_144660 |
| Alternative Names | SMSr; HEL-177 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Bilateral Hearing Impairment |