shRNA Adeno-associated Virus Serotype 2, pU6-(Scap-shRNA-Seq1)(CAT#: AAV-SI2281WQ)
This product is a Scap-shRNA encoding AAV, which is based on AAV-2 serotype. The Scap gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The expression of Scap-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Scap-shRNA-Seq1 |
Related Target/Protein | Scap |
Region | CDS |
TargetSeq | CATCCTGTTTGCCTACATCTA |
NCBI RefSeq | NM_001001144 |
Titer | >1*10^10 GC/mL |