shRNA Adeno-associated Virus Serotype 2, pU6-(SESTD1-shRNA-Seq2)(CAT#: AAV-SI0284WQ)
This product is a SESTD1-shRNA encoding AAV, which is based on AAV-2 serotype. The SESTD1 gene may act as the primary docking protein directing membrane turnover and assembly of the transient receptor potential channels TRPC4 and TRPC5. The expression of SESTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SESTD1-shRNA-Seq2 |
| Related Target/Protein | SESTD1 |
| Region | CDS |
| TargetSeq | GCTGAGTGTCACCTTAGACTT |
| NCBI RefSeq | NM_178123 |
| Alternative Names | SOLO |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lithium-responsive bipolar disorder |