shRNA Adeno-associated Virus Serotype 2, pU6-(SPACA7-shRNA-Seq1)(CAT#: AAV-SI0094WQ)
This product is a SPACA7-shRNA encoding AAV, which is based on AAV-2 serotype. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SPACA7-shRNA-Seq1 |
Related Target/Protein | SPACA7 |
Region | CDS |
TargetSeq | GCGATCCTTCTGAGAATTATC |
NCBI RefSeq | NM_145248 |
Alternative Names | C13orf28 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |