shRNA Adeno-associated Virus Serotype 2, pU6-(Vps13a-shRNA-Seq1)(CAT#: AAV-SI2215WQ)
This product is a Vps13a-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Vps13a gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. The expression of Vps13a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Vps13a-shRNA-Seq1 |
Related Target/Protein | Vps13a |
Region | CDS |
TargetSeq | CCGTTTACAGATGTCAGTATT |
NCBI RefSeq | NM_173028 |
Alternative Names | CHAC; CHOREIN |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive disorder, chorea-acanthocytosis |