shRNA Adeno-associated Virus Serotype 2, pU6-(WDR74-shRNA-Seq1)(CAT#: AAV-SI0451WQ)
This product is a WDR74-shRNA encoding AAV, which is based on AAV-2 serotype. The WDR74 gene participates in an early cleavage of the pre-rRNA processing pathway in cooperation with NVL and is required for blastocyst formation, is necessary for RNA transcription, processing and/or stability during preimplantation development. The expression of WDR74-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | WDR74-shRNA-Seq1 |
| Related Target/Protein | WDR74 |
| Region | CDS |
| TargetSeq | CTAGAAGACACAGAGACAGAT |
| NCBI RefSeq | NM_018093 |
| Alternative Names | Nsa1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mammary adenocarcinoma |