shRNA Adeno-associated Virus Serotype 2, pU6-(ZNF827-shRNA-Seq3)(CAT#: AAV-SI2288WQ)

This product is a ZNF827-shRNA encoding AAV, which is based on AAV-2 serotype. The ZNF827 gene encodes a protein that may be involved in transcriptional regulation. The expression of ZNF827-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ZNF827-shRNA-Seq3
Related Target/Protein ZNF827
Region CDS
TargetSeq CAACTTTGTCTGCAAGACGAA
NCBI RefSeq NM_178835
Titer >1*10^10 GC/mL
Target Gene
Gene ID 152485
Uniprot ID Q17R98

Related Products