shRNA Lentivirus (self-inactivating), pU6-(Lipk-shRNA-Seq1)(CAT#: LV-SI2228WQ)

Datasheet

This product is a Lipk-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Lipk gene plays a highly specific role in the last step of keratinocyte differentiation and may have an essential function in lipid metabolism of the most differentiated epidermal layers. The expression of Lipk-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lipk-shRNA-Seq1
Related Target/Protein Lipk
Region CDS
TargetSeq CCTTATCTACTACAAGGAGAT
NCBI RefSeq NM_172837
Alternative Names LIPL2; bA186O14.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 643414
Uniprot ID Q5VXJ0

Related Products

shRNA Lentivirus (self-inactivating), pH1-(OR4S2-shRNA-Seq3) (CAT#:LV-SI2980WQ) shRNA Lentivirus (self-inactivating), p7SK-(Olfr559-shRNA-Seq5) (CAT#:LV-SI3723WQ) shRNA Lentivirus (self-inactivating), pH1-(RBM33-shRNA-Seq1) (CAT#:LV-SI2955WQ) Recombinant lentivirus, pU6-(Fruit fly Ras1 3'UTR), Overexpression (CAT#:Lenti-GTOH0490WQ) shRNA Lentivirus (self-inactivating), pH1-(OR6B2-shRNA-Seq3) (CAT#:LV-SI2534WQ) shRNA Lentivirus (self-inactivating), pU6-(KIAA0495-shRNA-Seq2) (CAT#:LV-SI0426WQ) shRNA Lentivirus (self-inactivating), pU6-(C7orf64-shRNA-Seq4) (CAT#:LV-SI0326WQ) shRNA Lentivirus (self-inactivating), p7SK-(XKR6-shRNA-Seq1) (CAT#:LV-SI3696WQ)