shRNA Adeno-associated Virus Serotype 2, p7SK-(DZIP1L-shRNA-Seq1)(CAT#: AAV-SI1137WQ)
This product is a DZIP1L-shRNA encoding AAV, which is based on AAV-2 serotype. The DZIP1L gene encoded proterin is involved in primary cilium formation. Probably acts as a transition zone protein required for localization of PKD1/PC1 and PKD2/PC2 to the ciliary membrane. The expression of DZIP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | DZIP1L-shRNA-Seq1 |
Related Target/Protein | DZIP1L |
Region | CDS |
TargetSeq | GCCAAGCAGAACTCTACACTA |
NCBI RefSeq | NM_173543 |
Alternative Names | PKD5; DZIP2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Testis cancer |