shRNA Adeno-associated Virus Serotype 2, p7SK-(HSPA13-shRNA-Seq1)(CAT#: AAV-SI1363WQ)
This product is a HSPA13-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by HSPA13 gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The expression of HSPA13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | HSPA13-shRNA-Seq1 |
Related Target/Protein | HSPA13 |
Region | CDS |
TargetSeq | CCTAAAGTGATTGGTATTGAT |
NCBI RefSeq | NM_006948 |
Alternative Names | STCH |
Titer | >1*10^10 GC/mL |
Related Diseases | Oral Cancer |