shRNA Adeno-associated Virus Serotype 2, p7SK-(Med25-shRNA-Seq1)(CAT#: AAV-SI3921WQ)
This product is a Med25-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Med25 gene plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. The expression of Med25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Med25-shRNA-Seq1 |
| Related Target/Protein | Med25 |
| Region | CDS |
| TargetSeq | GCAGCTGTTCGATGACTTTAA |
| NCBI RefSeq | NM_029365 |
| Alternative Names | P78; ACID1; ARC92; BVSYS; PTOV2; CMT2B2; TCBAP0758 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Charcot-Marie-Tooth disease type 2B2 |
