shRNA Adeno-associated Virus Serotype 2, p7SK-(Olfr151-shRNA-Seq1)(CAT#: AAV-SI3965WQ)

This product is a Olfr151-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr151 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr151-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Olfr151-shRNA-Seq1
Related Target/Protein Olfr151
Region CDS
TargetSeq CCACAGCATTCATGTACTTAA
NCBI RefSeq NM_207664
Alternative Names M71; MOR171-2
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 406176
Uniprot ID Q60893

Related Products