shRNA Adeno-associated Virus Serotype 2, p7SK-(ZNF827-shRNA-Seq2)(CAT#: AAV-SI3987WQ)
This product is a ZNF827-shRNA encoding AAV, which is based on AAV-2 serotype. The ZNF827 gene encodes a protein that may be involved in transcriptional regulation. The expression of ZNF827-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ZNF827-shRNA-Seq2 |
| Related Target/Protein | ZNF827 |
| Region | CDS |
| TargetSeq | GAAGAATATCAGCTCCAGAAA |
| NCBI RefSeq | NM_178835 |
| Titer | >1*10^10 GC/mL |